ID: 957593856

View in Genome Browser
Species Human (GRCh38)
Location 3:82234744-82234766
Sequence CAGACCTTACAATCTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957593856_957593860 0 Left 957593856 3:82234744-82234766 CCTTCATTAGATTGTAAGGTCTG No data
Right 957593860 3:82234767-82234789 AGTAAGTAGGGACTGGTCACTGG No data
957593856_957593859 -7 Left 957593856 3:82234744-82234766 CCTTCATTAGATTGTAAGGTCTG No data
Right 957593859 3:82234760-82234782 AGGTCTGAGTAAGTAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957593856 Original CRISPR CAGACCTTACAATCTAATGA AGG (reversed) Intergenic
No off target data available for this crispr