ID: 957603348

View in Genome Browser
Species Human (GRCh38)
Location 3:82367325-82367347
Sequence CTGTAGCAATAGCTGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957603348_957603351 13 Left 957603348 3:82367325-82367347 CCAAGATTCAGCTATTGCTACAG No data
Right 957603351 3:82367361-82367383 TCTTGTCTACCTCTTAAGCTGGG No data
957603348_957603350 12 Left 957603348 3:82367325-82367347 CCAAGATTCAGCTATTGCTACAG No data
Right 957603350 3:82367360-82367382 ATCTTGTCTACCTCTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957603348 Original CRISPR CTGTAGCAATAGCTGAATCT TGG (reversed) Intergenic
No off target data available for this crispr