ID: 957610016

View in Genome Browser
Species Human (GRCh38)
Location 3:82453833-82453855
Sequence TAGAGCAGGGAGAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957610016_957610023 -6 Left 957610016 3:82453833-82453855 CCTGCCCCCTTCTCCCTGCTCTA No data
Right 957610023 3:82453850-82453872 GCTCTAGCCATGTGAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957610016 Original CRISPR TAGAGCAGGGAGAAGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr