ID: 957616930

View in Genome Browser
Species Human (GRCh38)
Location 3:82541799-82541821
Sequence CCTCTGCAACAGCTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957616930_957616935 22 Left 957616930 3:82541799-82541821 CCAGGGGCAAGCTGTTGCAGAGG No data
Right 957616935 3:82541844-82541866 TAATGAAGTTGTGAAATCATAGG No data
957616930_957616936 29 Left 957616930 3:82541799-82541821 CCAGGGGCAAGCTGTTGCAGAGG No data
Right 957616936 3:82541851-82541873 GTTGTGAAATCATAGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957616930 Original CRISPR CCTCTGCAACAGCTTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr