ID: 957624361

View in Genome Browser
Species Human (GRCh38)
Location 3:82640509-82640531
Sequence CAGTCTCCCTGAGCTCTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957624359_957624361 -2 Left 957624359 3:82640488-82640510 CCAAGTTGTGGCTGTAGATCTCA No data
Right 957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG No data
957624355_957624361 22 Left 957624355 3:82640464-82640486 CCTCCTGGGTGGGGCTGTAGCAG No data
Right 957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG No data
957624354_957624361 23 Left 957624354 3:82640463-82640485 CCCTCCTGGGTGGGGCTGTAGCA No data
Right 957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG No data
957624358_957624361 -1 Left 957624358 3:82640487-82640509 CCCAAGTTGTGGCTGTAGATCTC No data
Right 957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG No data
957624356_957624361 19 Left 957624356 3:82640467-82640489 CCTGGGTGGGGCTGTAGCAGCCC No data
Right 957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957624361 Original CRISPR CAGTCTCCCTGAGCTCTCGA GGG Intergenic
No off target data available for this crispr