ID: 957624728

View in Genome Browser
Species Human (GRCh38)
Location 3:82642969-82642991
Sequence CTCTGTCCTCTCTACCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957624721_957624728 23 Left 957624721 3:82642923-82642945 CCCTTTGACCCTCAGACTCTGGA No data
Right 957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG No data
957624722_957624728 22 Left 957624722 3:82642924-82642946 CCTTTGACCCTCAGACTCTGGAG No data
Right 957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG No data
957624723_957624728 15 Left 957624723 3:82642931-82642953 CCCTCAGACTCTGGAGAGAGAAA No data
Right 957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG No data
957624719_957624728 24 Left 957624719 3:82642922-82642944 CCCCTTTGACCCTCAGACTCTGG No data
Right 957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG No data
957624724_957624728 14 Left 957624724 3:82642932-82642954 CCTCAGACTCTGGAGAGAGAAAA No data
Right 957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957624728 Original CRISPR CTCTGTCCTCTCTACCAGAT GGG Intergenic
No off target data available for this crispr