ID: 957632858

View in Genome Browser
Species Human (GRCh38)
Location 3:82740560-82740582
Sequence ATGGAGAAGCAGAGAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957632848_957632858 29 Left 957632848 3:82740508-82740530 CCCTGTGAAGCAAGGTCAGGTGG No data
Right 957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG No data
957632850_957632858 28 Left 957632850 3:82740509-82740531 CCTGTGAAGCAAGGTCAGGTGGA No data
Right 957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957632858 Original CRISPR ATGGAGAAGCAGAGAGGAGA GGG Intergenic
No off target data available for this crispr