ID: 957634872

View in Genome Browser
Species Human (GRCh38)
Location 3:82769375-82769397
Sequence CAATTTATGGAAAGGCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957634868_957634872 9 Left 957634868 3:82769343-82769365 CCACGTACTTCATCTTTGAGTCA No data
Right 957634872 3:82769375-82769397 CAATTTATGGAAAGGCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957634872 Original CRISPR CAATTTATGGAAAGGCTGTA GGG Intergenic
No off target data available for this crispr