ID: 957637418

View in Genome Browser
Species Human (GRCh38)
Location 3:82804732-82804754
Sequence ATTAAATAGAAGTCAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957637416_957637418 -9 Left 957637416 3:82804718-82804740 CCTGAATCTGCCATATTAAATAG No data
Right 957637418 3:82804732-82804754 ATTAAATAGAAGTCAGCACAAGG No data
957637415_957637418 -2 Left 957637415 3:82804711-82804733 CCACAAACCTGAATCTGCCATAT No data
Right 957637418 3:82804732-82804754 ATTAAATAGAAGTCAGCACAAGG No data
957637414_957637418 2 Left 957637414 3:82804707-82804729 CCTACCACAAACCTGAATCTGCC No data
Right 957637418 3:82804732-82804754 ATTAAATAGAAGTCAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957637418 Original CRISPR ATTAAATAGAAGTCAGCACA AGG Intergenic
No off target data available for this crispr