ID: 957638492

View in Genome Browser
Species Human (GRCh38)
Location 3:82817613-82817635
Sequence GGCTAGGATTTGAAACTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957638492_957638500 28 Left 957638492 3:82817613-82817635 CCCCTGAGTTTCAAATCCTAGCC No data
Right 957638500 3:82817664-82817686 TGGCATCTTGCCCAAGTTCTTGG No data
957638492_957638499 8 Left 957638492 3:82817613-82817635 CCCCTGAGTTTCAAATCCTAGCC No data
Right 957638499 3:82817644-82817666 ACTAAATAGTTATGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957638492 Original CRISPR GGCTAGGATTTGAAACTCAG GGG (reversed) Intergenic
No off target data available for this crispr