ID: 957645839

View in Genome Browser
Species Human (GRCh38)
Location 3:82924743-82924765
Sequence ATGTATAGACAATTCAATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957645838_957645839 10 Left 957645838 3:82924710-82924732 CCACTGATTTTTTAGCTAATTTT No data
Right 957645839 3:82924743-82924765 ATGTATAGACAATTCAATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957645839 Original CRISPR ATGTATAGACAATTCAATCG AGG Intergenic
No off target data available for this crispr