ID: 957646574

View in Genome Browser
Species Human (GRCh38)
Location 3:82938970-82938992
Sequence TGGGCATCCCAGCGCTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957646562_957646574 18 Left 957646562 3:82938929-82938951 CCTGGACACAGCTGCCGCTGCCC No data
Right 957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG No data
957646571_957646574 -7 Left 957646571 3:82938954-82938976 CCGCATCTCGGGGACCTGGGCAT No data
Right 957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG No data
957646567_957646574 -2 Left 957646567 3:82938949-82938971 CCCAGCCGCATCTCGGGGACCTG No data
Right 957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG No data
957646564_957646574 4 Left 957646564 3:82938943-82938965 CCGCTGCCCAGCCGCATCTCGGG No data
Right 957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG No data
957646568_957646574 -3 Left 957646568 3:82938950-82938972 CCAGCCGCATCTCGGGGACCTGG No data
Right 957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957646574 Original CRISPR TGGGCATCCCAGCGCTCTCA GGG Intergenic
No off target data available for this crispr