ID: 957652639

View in Genome Browser
Species Human (GRCh38)
Location 3:83028868-83028890
Sequence CAGGCTTTTTTTCAGTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957652639_957652645 28 Left 957652639 3:83028868-83028890 CCTATCAACTGAAAAAAAGCCTG No data
Right 957652645 3:83028919-83028941 TCAGACATACACAGAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957652639 Original CRISPR CAGGCTTTTTTTCAGTTGAT AGG (reversed) Intergenic
No off target data available for this crispr