ID: 957665930

View in Genome Browser
Species Human (GRCh38)
Location 3:83226913-83226935
Sequence TAACCACAACAGATGCTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957665930_957665933 26 Left 957665930 3:83226913-83226935 CCATATAGCATCTGTTGTGGTTA No data
Right 957665933 3:83226962-83226984 TTAAGTCATGTAGCATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957665930 Original CRISPR TAACCACAACAGATGCTATA TGG (reversed) Intergenic
No off target data available for this crispr