ID: 957666496

View in Genome Browser
Species Human (GRCh38)
Location 3:83236866-83236888
Sequence TTTTCATATCTTAGGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957666496_957666500 3 Left 957666496 3:83236866-83236888 CCAGATAACCTAAGATATGAAAA No data
Right 957666500 3:83236892-83236914 CCATGCATTAGGTTGAAAAGAGG No data
957666496_957666501 19 Left 957666496 3:83236866-83236888 CCAGATAACCTAAGATATGAAAA No data
Right 957666501 3:83236908-83236930 AAAGAGGAAAAAGATGCTCCTGG No data
957666496_957666498 -8 Left 957666496 3:83236866-83236888 CCAGATAACCTAAGATATGAAAA No data
Right 957666498 3:83236881-83236903 TATGAAAAGAACCATGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957666496 Original CRISPR TTTTCATATCTTAGGTTATC TGG (reversed) Intergenic
No off target data available for this crispr