ID: 957666500

View in Genome Browser
Species Human (GRCh38)
Location 3:83236892-83236914
Sequence CCATGCATTAGGTTGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957666497_957666500 -5 Left 957666497 3:83236874-83236896 CCTAAGATATGAAAAGAACCATG No data
Right 957666500 3:83236892-83236914 CCATGCATTAGGTTGAAAAGAGG No data
957666496_957666500 3 Left 957666496 3:83236866-83236888 CCAGATAACCTAAGATATGAAAA No data
Right 957666500 3:83236892-83236914 CCATGCATTAGGTTGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957666500 Original CRISPR CCATGCATTAGGTTGAAAAG AGG Intergenic
No off target data available for this crispr