ID: 957668857

View in Genome Browser
Species Human (GRCh38)
Location 3:83274332-83274354
Sequence CAAGATCTGATGGGCTAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957668857_957668863 12 Left 957668857 3:83274332-83274354 CCCAATTAGCCCATCAGATCTTG No data
Right 957668863 3:83274367-83274389 ATTTTCACGAGAATAACATGGGG No data
957668857_957668861 10 Left 957668857 3:83274332-83274354 CCCAATTAGCCCATCAGATCTTG No data
Right 957668861 3:83274365-83274387 TCATTTTCACGAGAATAACATGG No data
957668857_957668862 11 Left 957668857 3:83274332-83274354 CCCAATTAGCCCATCAGATCTTG No data
Right 957668862 3:83274366-83274388 CATTTTCACGAGAATAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957668857 Original CRISPR CAAGATCTGATGGGCTAATT GGG (reversed) Intergenic
No off target data available for this crispr