ID: 957688464

View in Genome Browser
Species Human (GRCh38)
Location 3:83536371-83536393
Sequence ACTGATATCCAGAATTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957688461_957688464 23 Left 957688461 3:83536325-83536347 CCTGCAAAATGGGAAAAACGTTT No data
Right 957688464 3:83536371-83536393 ACTGATATCCAGAATTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957688464 Original CRISPR ACTGATATCCAGAATTTGCA AGG Intergenic
No off target data available for this crispr