ID: 957688961

View in Genome Browser
Species Human (GRCh38)
Location 3:83542580-83542602
Sequence GCCAAAAACACACATAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957688961_957688963 -1 Left 957688961 3:83542580-83542602 CCCTATCTATGTGTGTTTTTGGC No data
Right 957688963 3:83542602-83542624 CACCCTTGTTGACAATCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957688961 Original CRISPR GCCAAAAACACACATAGATA GGG (reversed) Intergenic
No off target data available for this crispr