ID: 957691504 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:83576730-83576752 |
| Sequence | ATGTTGCAGGTGAAGCCTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957691504_957691509 | 9 | Left | 957691504 | 3:83576730-83576752 | CCACAAGGCTTCACCTGCAACAT | No data | ||
| Right | 957691509 | 3:83576762-83576784 | CCTTTCAACATGAGATTTAGAGG | No data | ||||
| 957691504_957691510 | 10 | Left | 957691504 | 3:83576730-83576752 | CCACAAGGCTTCACCTGCAACAT | No data | ||
| Right | 957691510 | 3:83576763-83576785 | CTTTCAACATGAGATTTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957691504 | Original CRISPR | ATGTTGCAGGTGAAGCCTTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||