ID: 957691504

View in Genome Browser
Species Human (GRCh38)
Location 3:83576730-83576752
Sequence ATGTTGCAGGTGAAGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957691504_957691509 9 Left 957691504 3:83576730-83576752 CCACAAGGCTTCACCTGCAACAT No data
Right 957691509 3:83576762-83576784 CCTTTCAACATGAGATTTAGAGG No data
957691504_957691510 10 Left 957691504 3:83576730-83576752 CCACAAGGCTTCACCTGCAACAT No data
Right 957691510 3:83576763-83576785 CTTTCAACATGAGATTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957691504 Original CRISPR ATGTTGCAGGTGAAGCCTTG TGG (reversed) Intergenic
No off target data available for this crispr