ID: 957693409

View in Genome Browser
Species Human (GRCh38)
Location 3:83600720-83600742
Sequence CATAGTCAATAGGCACAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957693409_957693413 -9 Left 957693409 3:83600720-83600742 CCCTATTGTGCCTATTGACTATG No data
Right 957693413 3:83600734-83600756 TTGACTATGGTCAAACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957693409 Original CRISPR CATAGTCAATAGGCACAATA GGG (reversed) Intergenic
No off target data available for this crispr