ID: 957693410

View in Genome Browser
Species Human (GRCh38)
Location 3:83600721-83600743
Sequence CCATAGTCAATAGGCACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957693410_957693413 -10 Left 957693410 3:83600721-83600743 CCTATTGTGCCTATTGACTATGG No data
Right 957693413 3:83600734-83600756 TTGACTATGGTCAAACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957693410 Original CRISPR CCATAGTCAATAGGCACAAT AGG (reversed) Intergenic
No off target data available for this crispr