ID: 957694551

View in Genome Browser
Species Human (GRCh38)
Location 3:83618435-83618457
Sequence CCCAGCGGGTACTCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957694544_957694551 -9 Left 957694544 3:83618421-83618443 CCAGCCCCACACCACCCAGCGGG No data
Right 957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957694551 Original CRISPR CCCAGCGGGTACTCCGAGTC CGG Intergenic
No off target data available for this crispr