ID: 957695640

View in Genome Browser
Species Human (GRCh38)
Location 3:83635598-83635620
Sequence CCAGTCCCAATGAAGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957695640_957695649 20 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695649 3:83635641-83635663 AAGGAGGGTGAACAGAAGCAGGG No data
957695640_957695650 23 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG No data
957695640_957695644 1 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695644 3:83635622-83635644 TAGACAGTGGGTGCAGTCCAAGG 0: 3
1: 349
2: 946
3: 776
4: 454
957695640_957695645 4 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695645 3:83635625-83635647 ACAGTGGGTGCAGTCCAAGGAGG No data
957695640_957695648 19 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695648 3:83635640-83635662 CAAGGAGGGTGAACAGAAGCAGG No data
957695640_957695646 5 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695646 3:83635626-83635648 CAGTGGGTGCAGTCCAAGGAGGG No data
957695640_957695651 24 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695651 3:83635645-83635667 AGGGTGAACAGAAGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957695640 Original CRISPR CCAGTCCCAATGAAGTGAGC AGG (reversed) Intergenic
No off target data available for this crispr