ID: 957695650

View in Genome Browser
Species Human (GRCh38)
Location 3:83635644-83635666
Sequence GAGGGTGAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957695639_957695650 24 Left 957695639 3:83635597-83635619 CCCTGCTCACTTCATTGGGACTG No data
Right 957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG No data
957695640_957695650 23 Left 957695640 3:83635598-83635620 CCTGCTCACTTCATTGGGACTGG No data
Right 957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957695650 Original CRISPR GAGGGTGAACAGAAGCAGGG TGG Intergenic
No off target data available for this crispr