ID: 957697439 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:83658911-83658933 |
| Sequence | TTGCTGTTGTTGATGAGACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957697437_957697439 | 13 | Left | 957697437 | 3:83658875-83658897 | CCACAAGATGCTTGACATTGACA | No data | ||
| Right | 957697439 | 3:83658911-83658933 | TTGCTGTTGTTGATGAGACAGGG | No data | ||||
| 957697436_957697439 | 14 | Left | 957697436 | 3:83658874-83658896 | CCCACAAGATGCTTGACATTGAC | No data | ||
| Right | 957697439 | 3:83658911-83658933 | TTGCTGTTGTTGATGAGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957697439 | Original CRISPR | TTGCTGTTGTTGATGAGACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||