ID: 957697439

View in Genome Browser
Species Human (GRCh38)
Location 3:83658911-83658933
Sequence TTGCTGTTGTTGATGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957697437_957697439 13 Left 957697437 3:83658875-83658897 CCACAAGATGCTTGACATTGACA No data
Right 957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG No data
957697436_957697439 14 Left 957697436 3:83658874-83658896 CCCACAAGATGCTTGACATTGAC No data
Right 957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957697439 Original CRISPR TTGCTGTTGTTGATGAGACA GGG Intergenic
No off target data available for this crispr