ID: 957703761

View in Genome Browser
Species Human (GRCh38)
Location 3:83753310-83753332
Sequence TCCTGAACATCCCAGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957703761_957703762 -4 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703762 3:83753329-83753351 AGGATCAAAGTGCCAGCTTCTGG No data
957703761_957703769 25 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG No data
957703761_957703770 26 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703770 3:83753359-83753381 CACCATGGCAGAAGGTGGAAGGG No data
957703761_957703766 18 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703766 3:83753351-83753373 GTGAGGACCACCATGGCAGAAGG No data
957703761_957703763 1 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703763 3:83753334-83753356 CAAAGTGCCAGCTTCTGGTGAGG No data
957703761_957703767 21 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703767 3:83753354-83753376 AGGACCACCATGGCAGAAGGTGG No data
957703761_957703765 11 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703765 3:83753344-83753366 GCTTCTGGTGAGGACCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957703761 Original CRISPR TCCTGAACATCCCAGCCTCT AGG (reversed) Intergenic
No off target data available for this crispr