ID: 957703764

View in Genome Browser
Species Human (GRCh38)
Location 3:83753341-83753363
Sequence TGGTGGTCCTCACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957703764_957703773 13 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703773 3:83753377-83753399 AAGGGCAAGAGAGTACAAAAGGG No data
957703764_957703772 12 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703772 3:83753376-83753398 GAAGGGCAAGAGAGTACAAAAGG No data
957703764_957703767 -10 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703767 3:83753354-83753376 AGGACCACCATGGCAGAAGGTGG No data
957703764_957703769 -6 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG No data
957703764_957703774 28 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703774 3:83753392-83753414 CAAAAGGGTAAGCAGAAAAGTGG No data
957703764_957703770 -5 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703770 3:83753359-83753381 CACCATGGCAGAAGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957703764 Original CRISPR TGGTGGTCCTCACCAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr