ID: 957703769

View in Genome Browser
Species Human (GRCh38)
Location 3:83753358-83753380
Sequence CCACCATGGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957703761_957703769 25 Left 957703761 3:83753310-83753332 CCTAGAGGCTGGGATGTTCAGGA No data
Right 957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG No data
957703764_957703769 -6 Left 957703764 3:83753341-83753363 CCAGCTTCTGGTGAGGACCACCA No data
Right 957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957703769 Original CRISPR CCACCATGGCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr