ID: 957710846

View in Genome Browser
Species Human (GRCh38)
Location 3:83857766-83857788
Sequence TTTCATATGTAAAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957710846_957710849 28 Left 957710846 3:83857766-83857788 CCATCCACATTTTACATATGAAA No data
Right 957710849 3:83857817-83857839 AGCCCAAGAACTTTGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957710846 Original CRISPR TTTCATATGTAAAATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr