ID: 957711003

View in Genome Browser
Species Human (GRCh38)
Location 3:83859713-83859735
Sequence CACAGGGATGGAGCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957711003_957711017 19 Left 957711003 3:83859713-83859735 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 957711017 3:83859755-83859777 CCACAGCTGCTTTGGTGGGCTGG No data
957711003_957711010 11 Left 957711003 3:83859713-83859735 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 957711010 3:83859747-83859769 TACAGCCCCCACAGCTGCTTTGG No data
957711003_957711011 14 Left 957711003 3:83859713-83859735 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 957711011 3:83859750-83859772 AGCCCCCACAGCTGCTTTGGTGG No data
957711003_957711012 15 Left 957711003 3:83859713-83859735 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 957711012 3:83859751-83859773 GCCCCCACAGCTGCTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957711003 Original CRISPR CACAGGGATGGAGCTGCCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr