ID: 957711193

View in Genome Browser
Species Human (GRCh38)
Location 3:83861169-83861191
Sequence CTCTATCACAAGAGCAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957711191_957711193 -7 Left 957711191 3:83861153-83861175 CCACATCTCATGAGAACTCTATC No data
Right 957711193 3:83861169-83861191 CTCTATCACAAGAGCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957711193 Original CRISPR CTCTATCACAAGAGCAGCAA GGG Intergenic
No off target data available for this crispr