ID: 957717368

View in Genome Browser
Species Human (GRCh38)
Location 3:83946091-83946113
Sequence CCTTATATAGAGAGGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957717363_957717368 0 Left 957717363 3:83946068-83946090 CCAGAATTACATTCCCTATTATG No data
Right 957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG No data
957717361_957717368 2 Left 957717361 3:83946066-83946088 CCCCAGAATTACATTCCCTATTA No data
Right 957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG No data
957717362_957717368 1 Left 957717362 3:83946067-83946089 CCCAGAATTACATTCCCTATTAT No data
Right 957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957717368 Original CRISPR CCTTATATAGAGAGGTAAGA TGG Intergenic
No off target data available for this crispr