ID: 957717967

View in Genome Browser
Species Human (GRCh38)
Location 3:83956552-83956574
Sequence TCTGTGTTGCTGGGAGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957717962_957717967 -4 Left 957717962 3:83956533-83956555 CCTTTCATTCCCTTGTGTGTCTG No data
Right 957717967 3:83956552-83956574 TCTGTGTTGCTGGGAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957717967 Original CRISPR TCTGTGTTGCTGGGAGACCT AGG Intergenic