ID: 957719643

View in Genome Browser
Species Human (GRCh38)
Location 3:83977561-83977583
Sequence GAACAATGGATGGCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957719643_957719647 21 Left 957719643 3:83977561-83977583 CCAGTCTCTGCCATCCATTGTTC No data
Right 957719647 3:83977605-83977627 CAAATTTTTAGCTCCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957719643 Original CRISPR GAACAATGGATGGCAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr