ID: 957723173

View in Genome Browser
Species Human (GRCh38)
Location 3:84031331-84031353
Sequence GCCATGGGCCTTTGGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957723166_957723173 22 Left 957723166 3:84031286-84031308 CCAGGGGAATGGGTGAGTTGAAC No data
Right 957723173 3:84031331-84031353 GCCATGGGCCTTTGGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957723173 Original CRISPR GCCATGGGCCTTTGGATCCC TGG Intergenic
No off target data available for this crispr