ID: 957724113

View in Genome Browser
Species Human (GRCh38)
Location 3:84042491-84042513
Sequence TAGCCAAGGCTGTCTGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957724109_957724113 2 Left 957724109 3:84042466-84042488 CCTACTTCCTCAATAACCTTCAC No data
Right 957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG No data
957724110_957724113 -5 Left 957724110 3:84042473-84042495 CCTCAATAACCTTCACTCTAGCC No data
Right 957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG No data
957724107_957724113 29 Left 957724107 3:84042439-84042461 CCAATATATTTCATTGATGACAC No data
Right 957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG No data
957724108_957724113 3 Left 957724108 3:84042465-84042487 CCCTACTTCCTCAATAACCTTCA No data
Right 957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957724113 Original CRISPR TAGCCAAGGCTGTCTGTGAC TGG Intergenic
No off target data available for this crispr