ID: 957724208

View in Genome Browser
Species Human (GRCh38)
Location 3:84044035-84044057
Sequence ATTTATCCATAGATGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957724205_957724208 1 Left 957724205 3:84044011-84044033 CCAGAGACAAGTTTGTGGAAGAC No data
Right 957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG No data
957724201_957724208 17 Left 957724201 3:84043995-84044017 CCCTACCTTTTTGGCACCAGAGA No data
Right 957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG No data
957724203_957724208 12 Left 957724203 3:84044000-84044022 CCTTTTTGGCACCAGAGACAAGT No data
Right 957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG No data
957724199_957724208 26 Left 957724199 3:84043986-84044008 CCAGCAGTTCCCTACCTTTTTGG No data
Right 957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG No data
957724202_957724208 16 Left 957724202 3:84043996-84044018 CCTACCTTTTTGGCACCAGAGAC 0: 72
1: 1078
2: 1756
3: 1387
4: 967
Right 957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957724208 Original CRISPR ATTTATCCATAGATGGAGGT TGG Intergenic
No off target data available for this crispr