ID: 957724799

View in Genome Browser
Species Human (GRCh38)
Location 3:84050001-84050023
Sequence ATGTCATTTTAGAAAAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957724799_957724802 18 Left 957724799 3:84050001-84050023 CCTTCGCTTTTCTAAAATGACAT No data
Right 957724802 3:84050042-84050064 TCCATAGTTTAGTATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957724799 Original CRISPR ATGTCATTTTAGAAAAGCGA AGG (reversed) Intergenic
No off target data available for this crispr