ID: 957726247

View in Genome Browser
Species Human (GRCh38)
Location 3:84071137-84071159
Sequence GGGGATTCCTTGGGAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957726247_957726259 25 Left 957726247 3:84071137-84071159 CCTATTTTTCCCAAGGAATCCCC No data
Right 957726259 3:84071185-84071207 TCTTATATGTGTGTTAAGGTTGG No data
957726247_957726254 -1 Left 957726247 3:84071137-84071159 CCTATTTTTCCCAAGGAATCCCC No data
Right 957726254 3:84071159-84071181 CAGCTGCCGGAAGTTATCTTAGG No data
957726247_957726255 0 Left 957726247 3:84071137-84071159 CCTATTTTTCCCAAGGAATCCCC No data
Right 957726255 3:84071160-84071182 AGCTGCCGGAAGTTATCTTAGGG No data
957726247_957726257 21 Left 957726247 3:84071137-84071159 CCTATTTTTCCCAAGGAATCCCC No data
Right 957726257 3:84071181-84071203 GGCCTCTTATATGTGTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957726247 Original CRISPR GGGGATTCCTTGGGAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr