ID: 957730187

View in Genome Browser
Species Human (GRCh38)
Location 3:84125138-84125160
Sequence GCAGCAGCGGCCCATCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957730182_957730187 -6 Left 957730182 3:84125121-84125143 CCCAAATACTACTGATGGCAGCA No data
Right 957730187 3:84125138-84125160 GCAGCAGCGGCCCATCTGGAGGG No data
957730183_957730187 -7 Left 957730183 3:84125122-84125144 CCAAATACTACTGATGGCAGCAG No data
Right 957730187 3:84125138-84125160 GCAGCAGCGGCCCATCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957730187 Original CRISPR GCAGCAGCGGCCCATCTGGA GGG Intergenic
No off target data available for this crispr