ID: 957730482

View in Genome Browser
Species Human (GRCh38)
Location 3:84126583-84126605
Sequence CCATGTACACACATAGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957730482_957730484 5 Left 957730482 3:84126583-84126605 CCAAACTCTATGTGTGTACATGG No data
Right 957730484 3:84126611-84126633 TACACACACACTATGTGTACAGG No data
957730482_957730485 6 Left 957730482 3:84126583-84126605 CCAAACTCTATGTGTGTACATGG No data
Right 957730485 3:84126612-84126634 ACACACACACTATGTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957730482 Original CRISPR CCATGTACACACATAGAGTT TGG (reversed) Intergenic
No off target data available for this crispr