ID: 957730484

View in Genome Browser
Species Human (GRCh38)
Location 3:84126611-84126633
Sequence TACACACACACTATGTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957730479_957730484 16 Left 957730479 3:84126572-84126594 CCTAAGGATCCCCAAACTCTATG No data
Right 957730484 3:84126611-84126633 TACACACACACTATGTGTACAGG No data
957730481_957730484 6 Left 957730481 3:84126582-84126604 CCCAAACTCTATGTGTGTACATG No data
Right 957730484 3:84126611-84126633 TACACACACACTATGTGTACAGG No data
957730480_957730484 7 Left 957730480 3:84126581-84126603 CCCCAAACTCTATGTGTGTACAT No data
Right 957730484 3:84126611-84126633 TACACACACACTATGTGTACAGG No data
957730482_957730484 5 Left 957730482 3:84126583-84126605 CCAAACTCTATGTGTGTACATGG No data
Right 957730484 3:84126611-84126633 TACACACACACTATGTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957730484 Original CRISPR TACACACACACTATGTGTAC AGG Intergenic
No off target data available for this crispr