ID: 957730536

View in Genome Browser
Species Human (GRCh38)
Location 3:84127881-84127903
Sequence GCTAAGACACAGAACAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957730536_957730538 -6 Left 957730536 3:84127881-84127903 CCTACCTTGTTCTGTGTCTTAGC No data
Right 957730538 3:84127898-84127920 CTTAGCACGCTAAATCTTACAGG No data
957730536_957730540 22 Left 957730536 3:84127881-84127903 CCTACCTTGTTCTGTGTCTTAGC No data
Right 957730540 3:84127926-84127948 TCAAAGGTCTCCTTGCTTTCTGG No data
957730536_957730539 6 Left 957730536 3:84127881-84127903 CCTACCTTGTTCTGTGTCTTAGC No data
Right 957730539 3:84127910-84127932 AATCTTACAGGTAACATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957730536 Original CRISPR GCTAAGACACAGAACAAGGT AGG (reversed) Intergenic
No off target data available for this crispr