ID: 957733862

View in Genome Browser
Species Human (GRCh38)
Location 3:84180652-84180674
Sequence CAATATACAAAGGCAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957733862_957733867 28 Left 957733862 3:84180652-84180674 CCTTGCTCTGCCTTTGTATATTG No data
Right 957733867 3:84180703-84180725 AACGTGCTTTTTCTTTTGTAAGG No data
957733862_957733866 -6 Left 957733862 3:84180652-84180674 CCTTGCTCTGCCTTTGTATATTG No data
Right 957733866 3:84180669-84180691 ATATTGTGTGTTTGGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957733862 Original CRISPR CAATATACAAAGGCAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr