ID: 957734046

View in Genome Browser
Species Human (GRCh38)
Location 3:84183053-84183075
Sequence AGCACCGTGATGTAAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957734044_957734046 18 Left 957734044 3:84183012-84183034 CCACGCTTAAAAGACTTAAGACT No data
Right 957734046 3:84183053-84183075 AGCACCGTGATGTAAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957734046 Original CRISPR AGCACCGTGATGTAAAGCAC AGG Intergenic
No off target data available for this crispr