ID: 957734318 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:84187414-84187436 |
| Sequence | GTGGTAAGAGGCAATATTGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957734313_957734318 | 13 | Left | 957734313 | 3:84187378-84187400 | CCTAGAGTGGGAGAGATTAAGCT | 0: 596 1: 221 2: 95 3: 60 4: 179 |
||
| Right | 957734318 | 3:84187414-84187436 | GTGGTAAGAGGCAATATTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957734318 | Original CRISPR | GTGGTAAGAGGCAATATTGT GGG | Intergenic | ||
| No off target data available for this crispr | |||||