ID: 957734318

View in Genome Browser
Species Human (GRCh38)
Location 3:84187414-84187436
Sequence GTGGTAAGAGGCAATATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957734313_957734318 13 Left 957734313 3:84187378-84187400 CCTAGAGTGGGAGAGATTAAGCT 0: 596
1: 221
2: 95
3: 60
4: 179
Right 957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957734318 Original CRISPR GTGGTAAGAGGCAATATTGT GGG Intergenic
No off target data available for this crispr