ID: 957738625

View in Genome Browser
Species Human (GRCh38)
Location 3:84233838-84233860
Sequence CTAGTGGAGCTGTGAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957738625_957738631 5 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738631 3:84233866-84233888 GACCCAGTGGGAACCCCGTGTGG No data
957738625_957738630 -7 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738630 3:84233854-84233876 CCACTAGGCAGTGACCCAGTGGG No data
957738625_957738628 -8 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738628 3:84233853-84233875 TCCACTAGGCAGTGACCCAGTGG No data
957738625_957738632 6 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738632 3:84233867-84233889 ACCCAGTGGGAACCCCGTGTGGG No data
957738625_957738634 7 Left 957738625 3:84233838-84233860 CCCTCTACTCACAGCTCCACTAG No data
Right 957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957738625 Original CRISPR CTAGTGGAGCTGTGAGTAGA GGG (reversed) Intergenic