ID: 957738626

View in Genome Browser
Species Human (GRCh38)
Location 3:84233839-84233861
Sequence CCTAGTGGAGCTGTGAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957738626_957738632 5 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738632 3:84233867-84233889 ACCCAGTGGGAACCCCGTGTGGG No data
957738626_957738628 -9 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738628 3:84233853-84233875 TCCACTAGGCAGTGACCCAGTGG No data
957738626_957738634 6 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG No data
957738626_957738630 -8 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738630 3:84233854-84233876 CCACTAGGCAGTGACCCAGTGGG 0: 18
1: 1133
2: 1641
3: 1620
4: 1338
957738626_957738631 4 Left 957738626 3:84233839-84233861 CCTCTACTCACAGCTCCACTAGG No data
Right 957738631 3:84233866-84233888 GACCCAGTGGGAACCCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957738626 Original CRISPR CCTAGTGGAGCTGTGAGTAG AGG (reversed) Intergenic
No off target data available for this crispr