ID: 957738629

View in Genome Browser
Species Human (GRCh38)
Location 3:84233854-84233876
Sequence CCCACTGGGTCACTGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957738629_957738634 -9 Left 957738629 3:84233854-84233876 CCACTAGGCAGTGACCCAGTGGG No data
Right 957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG No data
957738629_957738632 -10 Left 957738629 3:84233854-84233876 CCACTAGGCAGTGACCCAGTGGG No data
Right 957738632 3:84233867-84233889 ACCCAGTGGGAACCCCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957738629 Original CRISPR CCCACTGGGTCACTGCCTAG TGG (reversed) Intergenic
No off target data available for this crispr